protease/phosphatase inhibitor cocktail set (Merck KGaA)
90
Structured Review
Merck KGaA
protease/phosphatase inhibitor cocktail set
Protease/Phosphatase Inhibitor Cocktail Set, supplied by Merck KGaA, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/protease+inhibitor+cocktail+set/protease+and+phosphatase+inhibitor+cocktail/pmc12265377-73-25-29
Average 90 stars, based on 1 article reviews
Protease/Phosphatase Inhibitor Cocktail Set, supplied by Merck KGaA, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/protease+inhibitor+cocktail+set/protease+and+phosphatase+inhibitor+cocktail/pmc12265377-73-25-29
Average 90 stars, based on 1 article reviews
protease/phosphatase inhibitor cocktail set - by Bioz Stars,
2026-09
90/100 stars
Images
Related Articles
Lysis:Article Title: Effect of dapagliflozin on oxidative stress in heart embryonic H9c2 cardiomyocytes Article Snippet: .. Using 1xRipa lysis buffer and a Article Title: The transcription factor ACE3 controls cellulase activities and lactose metabolism via two additional regulators in the fungus Trichoderma reesei Article Snippet: .. The cell lysate was obtained by bead-beating in lysis buffer (50 mM Tris-HCl, pH 7.5, 100 mM NaCl, 1% NP-40 (Beyotime), 0.1 mM PMSF, and 1× Article Title: Trichoderma reesei ACE4, a Novel Transcriptional Activator Involved in the Regulation of Cellulase Genes during Growth on Cellulose Article Snippet: .. This crude lysate was dissolved in lysis buffer (50 mM Tris-HCl, 100 mM NaCl, 1% NP-40 [Beyotime], 0.1 mM PMSF, and 1× Protease Inhibitor:Article Title: Effect of dapagliflozin on oxidative stress in heart embryonic H9c2 cardiomyocytes Article Snippet: .. Using 1xRipa lysis buffer and a Article Title: CRISPR-Induced Expression of N-Terminally Truncated Dicer in Mouse Cells Article Snippet: .. Before collection, the cells were washed with PBS and lysed in RIPA buffer (50 mM Tris, pH 7.5, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% NP-40 (Igepal CA-630), 0.5% Na-deoxycholate, 0.1% SDS) supplemented with 2× Article Title: Structural and functional insights into TRiC chaperonin from a psychrophilic yeast, Glaciozyma antarctica Article Snippet: .. Harvested cells from G. antarctica culture were homogenized in buffer A containing 20 mM Tris (pH 8), 20 mM KCL, 1 mM EDTA, 1 mM DTT, 1 mM MgCl 2, 0.5 mM PMSF, Article Title: The transcription factor ACE3 controls cellulase activities and lactose metabolism via two additional regulators in the fungus Trichoderma reesei Article Snippet: .. The cell lysate was obtained by bead-beating in lysis buffer (50 mM Tris-HCl, pH 7.5, 100 mM NaCl, 1% NP-40 (Beyotime), 0.1 mM PMSF, and 1× Article Title: Trichoderma reesei ACE4, a Novel Transcriptional Activator Involved in the Regulation of Cellulase Genes during Growth on Cellulose Article Snippet: .. This crude lysate was dissolved in lysis buffer (50 mM Tris-HCl, 100 mM NaCl, 1% NP-40 [Beyotime], 0.1 mM PMSF, and 1× Article Title: Integrin α3 negative podocytes: A gene expression study Article Snippet: .. The two cell types were lysed with a buffer containing 25 mM Tris-HCl, pH 7.4, 100 mM NaCl, 1% NP-40, 1 mM PEFA-Bloc, 2 mM EDTA and Article Title: Reduction of 2-methoxy-1,4-naphtoquinone by mitochondrially-localized Nqo1 yielding NAD + supports substrate-level phosphorylation during respiratory inhibition. Article Snippet: .. Cells were solubilized in RIPA buffer containing a cocktail of protease inhibitors ( Article Title: Structural and functional insights into TRiC chaperonin from a psychrophilic yeast, Glaciozyma antarctica Article Snippet: .. Melting curves analysis of the PCR reactions were done to analyze the specificity of each set of primers. table ft1 table-wrap mode="anchored" t5 Table 1 caption a7 Primers Sequence (5–3′) GaTRiCαF-RT GTACTTGACGGAGCAGCTTT GaTRiCαR-RT ATGCTCGCAGTCAAGACCA GaTRiCβF-RT CAAGAGCGAGCAGAGAATGTC GaTRiCβR-RT AGATCACGGTCACCAACGAC GaTRiCγF-RT ATGGAGAGACGGGCAAGGT GaTRiCγR-RT GAGGAGTGCAGAACATGGG GaTRiCδF-RT ATGGCTGCACCTACCACT GaTRiCδR-RT ATGGACAAGATGATCACGACC GaTRiCεF-RT ATCGATTGCGCTGGAAAGGG GaTRiCεR-RT GGTGGTGGAGACGAGGAGTA GaTRiCζF-RT GGTTGTGCAGGGAAGGAAC GaTRiCζR-RT GTAACCAAGCCTTCCAGATCAA GaTRiCηF-RT AGGCCGAATGCCCTACAT GaTRiCηR-RT GGTATGGACAAGCTCATCGTC GaTRiCθF-RT TCAGTAGGCTGTATGCTGCG GaTRiCθR-RT ATTCGCTACGGTACTGACGC Open in a separate window Primers were named based on the TRiC subunits (subunit α, β, γ, δ, ε, ζ, η, and θ), F indicates forward primers, R is for reverse primers, and RT indicates real-time PCR Primers used in real-time PCR analysis Preparation of cells, purification, and protein analysis Harvested cells from G. antarctica culture were homogenized in buffer A containing 20 mM Tris (pH 8), 20 mM KCL, 1 mM EDTA, 1 mM DTT, 1 mM MgCl 2, 0.5 mM PMSF, Polymerase Chain Reaction:Article Title: Structural and functional insights into TRiC chaperonin from a psychrophilic yeast, Glaciozyma antarctica Article Snippet: .. Melting curves analysis of the PCR reactions were done to analyze the specificity of each set of primers. table ft1 table-wrap mode="anchored" t5 Table 1 caption a7 Primers Sequence (5–3′) GaTRiCαF-RT GTACTTGACGGAGCAGCTTT GaTRiCαR-RT ATGCTCGCAGTCAAGACCA GaTRiCβF-RT CAAGAGCGAGCAGAGAATGTC GaTRiCβR-RT AGATCACGGTCACCAACGAC GaTRiCγF-RT ATGGAGAGACGGGCAAGGT GaTRiCγR-RT GAGGAGTGCAGAACATGGG GaTRiCδF-RT ATGGCTGCACCTACCACT GaTRiCδR-RT ATGGACAAGATGATCACGACC GaTRiCεF-RT ATCGATTGCGCTGGAAAGGG GaTRiCεR-RT GGTGGTGGAGACGAGGAGTA GaTRiCζF-RT GGTTGTGCAGGGAAGGAAC GaTRiCζR-RT GTAACCAAGCCTTCCAGATCAA GaTRiCηF-RT AGGCCGAATGCCCTACAT GaTRiCηR-RT GGTATGGACAAGCTCATCGTC GaTRiCθF-RT TCAGTAGGCTGTATGCTGCG GaTRiCθR-RT ATTCGCTACGGTACTGACGC Open in a separate window Primers were named based on the TRiC subunits (subunit α, β, γ, δ, ε, ζ, η, and θ), F indicates forward primers, R is for reverse primers, and RT indicates real-time PCR Primers used in real-time PCR analysis Preparation of cells, purification, and protein analysis Harvested cells from G. antarctica culture were homogenized in buffer A containing 20 mM Tris (pH 8), 20 mM KCL, 1 mM EDTA, 1 mM DTT, 1 mM MgCl 2, 0.5 mM PMSF, Sequencing:Article Title: Structural and functional insights into TRiC chaperonin from a psychrophilic yeast, Glaciozyma antarctica Article Snippet: .. Melting curves analysis of the PCR reactions were done to analyze the specificity of each set of primers. table ft1 table-wrap mode="anchored" t5 Table 1 caption a7 Primers Sequence (5–3′) GaTRiCαF-RT GTACTTGACGGAGCAGCTTT GaTRiCαR-RT ATGCTCGCAGTCAAGACCA GaTRiCβF-RT CAAGAGCGAGCAGAGAATGTC GaTRiCβR-RT AGATCACGGTCACCAACGAC GaTRiCγF-RT ATGGAGAGACGGGCAAGGT GaTRiCγR-RT GAGGAGTGCAGAACATGGG GaTRiCδF-RT ATGGCTGCACCTACCACT GaTRiCδR-RT ATGGACAAGATGATCACGACC GaTRiCεF-RT ATCGATTGCGCTGGAAAGGG GaTRiCεR-RT GGTGGTGGAGACGAGGAGTA GaTRiCζF-RT GGTTGTGCAGGGAAGGAAC GaTRiCζR-RT GTAACCAAGCCTTCCAGATCAA GaTRiCηF-RT AGGCCGAATGCCCTACAT GaTRiCηR-RT GGTATGGACAAGCTCATCGTC GaTRiCθF-RT TCAGTAGGCTGTATGCTGCG GaTRiCθR-RT ATTCGCTACGGTACTGACGC Open in a separate window Primers were named based on the TRiC subunits (subunit α, β, γ, δ, ε, ζ, η, and θ), F indicates forward primers, R is for reverse primers, and RT indicates real-time PCR Primers used in real-time PCR analysis Preparation of cells, purification, and protein analysis Harvested cells from G. antarctica culture were homogenized in buffer A containing 20 mM Tris (pH 8), 20 mM KCL, 1 mM EDTA, 1 mM DTT, 1 mM MgCl 2, 0.5 mM PMSF, Real-time Polymerase Chain Reaction:Article Title: Structural and functional insights into TRiC chaperonin from a psychrophilic yeast, Glaciozyma antarctica Article Snippet: .. Melting curves analysis of the PCR reactions were done to analyze the specificity of each set of primers. table ft1 table-wrap mode="anchored" t5 Table 1 caption a7 Primers Sequence (5–3′) GaTRiCαF-RT GTACTTGACGGAGCAGCTTT GaTRiCαR-RT ATGCTCGCAGTCAAGACCA GaTRiCβF-RT CAAGAGCGAGCAGAGAATGTC GaTRiCβR-RT AGATCACGGTCACCAACGAC GaTRiCγF-RT ATGGAGAGACGGGCAAGGT GaTRiCγR-RT GAGGAGTGCAGAACATGGG GaTRiCδF-RT ATGGCTGCACCTACCACT GaTRiCδR-RT ATGGACAAGATGATCACGACC GaTRiCεF-RT ATCGATTGCGCTGGAAAGGG GaTRiCεR-RT GGTGGTGGAGACGAGGAGTA GaTRiCζF-RT GGTTGTGCAGGGAAGGAAC GaTRiCζR-RT GTAACCAAGCCTTCCAGATCAA GaTRiCηF-RT AGGCCGAATGCCCTACAT GaTRiCηR-RT GGTATGGACAAGCTCATCGTC GaTRiCθF-RT TCAGTAGGCTGTATGCTGCG GaTRiCθR-RT ATTCGCTACGGTACTGACGC Open in a separate window Primers were named based on the TRiC subunits (subunit α, β, γ, δ, ε, ζ, η, and θ), F indicates forward primers, R is for reverse primers, and RT indicates real-time PCR Primers used in real-time PCR analysis Preparation of cells, purification, and protein analysis Harvested cells from G. antarctica culture were homogenized in buffer A containing 20 mM Tris (pH 8), 20 mM KCL, 1 mM EDTA, 1 mM DTT, 1 mM MgCl 2, 0.5 mM PMSF, Purification:Article Title: Structural and functional insights into TRiC chaperonin from a psychrophilic yeast, Glaciozyma antarctica Article Snippet: .. Melting curves analysis of the PCR reactions were done to analyze the specificity of each set of primers. table ft1 table-wrap mode="anchored" t5 Table 1 caption a7 Primers Sequence (5–3′) GaTRiCαF-RT GTACTTGACGGAGCAGCTTT GaTRiCαR-RT ATGCTCGCAGTCAAGACCA GaTRiCβF-RT CAAGAGCGAGCAGAGAATGTC GaTRiCβR-RT AGATCACGGTCACCAACGAC GaTRiCγF-RT ATGGAGAGACGGGCAAGGT GaTRiCγR-RT GAGGAGTGCAGAACATGGG GaTRiCδF-RT ATGGCTGCACCTACCACT GaTRiCδR-RT ATGGACAAGATGATCACGACC GaTRiCεF-RT ATCGATTGCGCTGGAAAGGG GaTRiCεR-RT GGTGGTGGAGACGAGGAGTA GaTRiCζF-RT GGTTGTGCAGGGAAGGAAC GaTRiCζR-RT GTAACCAAGCCTTCCAGATCAA GaTRiCηF-RT AGGCCGAATGCCCTACAT GaTRiCηR-RT GGTATGGACAAGCTCATCGTC GaTRiCθF-RT TCAGTAGGCTGTATGCTGCG GaTRiCθR-RT ATTCGCTACGGTACTGACGC Open in a separate window Primers were named based on the TRiC subunits (subunit α, β, γ, δ, ε, ζ, η, and θ), F indicates forward primers, R is for reverse primers, and RT indicates real-time PCR Primers used in real-time PCR analysis Preparation of cells, purification, and protein analysis Harvested cells from G. antarctica culture were homogenized in buffer A containing 20 mM Tris (pH 8), 20 mM KCL, 1 mM EDTA, 1 mM DTT, 1 mM MgCl 2, 0.5 mM PMSF, |