Review




Structured Review

Merck KGaA protease/phosphatase inhibitor cocktail set
Protease/Phosphatase Inhibitor Cocktail Set, supplied by Merck KGaA, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/protease+inhibitor+cocktail+set/protease+and+phosphatase+inhibitor+cocktail/pmc12265377-73-25-29
Average 90 stars, based on 1 article reviews
protease/phosphatase inhibitor cocktail set - by Bioz Stars, 2026-09
90/100 stars

Images

Related Articles

Lysis:

Article Title: Effect of dapagliflozin on oxidative stress in heart embryonic H9c2 cardiomyocytes
Article Snippet: .. Using 1xRipa lysis buffer and a protease inhibitor cocktail set (Merck KGaA, Darmstadt, Germany), a cell lysate from all groups was created at the conclusion of the experiment. ..

Article Title: The transcription factor ACE3 controls cellulase activities and lactose metabolism via two additional regulators in the fungus Trichoderma reesei
Article Snippet: .. The cell lysate was obtained by bead-beating in lysis buffer (50 mM Tris-HCl, pH 7.5, 100 mM NaCl, 1% NP-40 (Beyotime), 0.1 mM PMSF, and 1× protease inhibitor cocktail set I (Merck Millipore) (51). .. One milliliter aliquots were mixed with 1.8 g glass beads (Biospec Products, Bartlesville, OK) in a 2.0 mL screw-cap tube followed by disruption with a bead disrupter (FastPrep-24, MP) for 20 cycles (1 min vibrating at 6.0 m/s and 5 min resting on ice for each cycle).

Article Title: Trichoderma reesei ACE4, a Novel Transcriptional Activator Involved in the Regulation of Cellulase Genes during Growth on Cellulose
Article Snippet: .. This crude lysate was dissolved in lysis buffer (50 mM Tris-HCl, 100 mM NaCl, 1% NP-40 [Beyotime], 0.1 mM PMSF, and 1× protease inhibitor cocktail set I [Merck Millipore; pH 7.5]). ..

Protease Inhibitor:

Article Title: Effect of dapagliflozin on oxidative stress in heart embryonic H9c2 cardiomyocytes
Article Snippet: .. Using 1xRipa lysis buffer and a protease inhibitor cocktail set (Merck KGaA, Darmstadt, Germany), a cell lysate from all groups was created at the conclusion of the experiment. ..

Article Title: CRISPR-Induced Expression of N-Terminally Truncated Dicer in Mouse Cells
Article Snippet: .. Before collection, the cells were washed with PBS and lysed in RIPA buffer (50 mM Tris, pH 7.5, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% NP-40 (Igepal CA-630), 0.5% Na-deoxycholate, 0.1% SDS) supplemented with 2× protease inhibitor cocktail set (Merck Millipore, Germany). .. Proteins were separated in 5% (for Dicer detection) or 10% (for Tubulin detection) polyacrylamide gel and transferred to a PVFD membrane (Merck Millipore, Germany).

Article Title: Structural and functional insights into TRiC chaperonin from a psychrophilic yeast, Glaciozyma antarctica
Article Snippet: .. Harvested cells from G. antarctica culture were homogenized in buffer A containing 20 mM Tris (pH 8), 20 mM KCL, 1 mM EDTA, 1 mM DTT, 1 mM MgCl 2, 0.5 mM PMSF, 1X protease inhibitor cocktail set (500 μM AEBSF hydrochloride, 150 nM Aprotinin, 1 μM E-64 protease inhibitor, 0.5 mM EDTA and 1 μM Leupeptin) (Merck Millipore, Germany) at 4 °C for 50 g cells per 50 mL buffer A. ..

Article Title: The transcription factor ACE3 controls cellulase activities and lactose metabolism via two additional regulators in the fungus Trichoderma reesei
Article Snippet: .. The cell lysate was obtained by bead-beating in lysis buffer (50 mM Tris-HCl, pH 7.5, 100 mM NaCl, 1% NP-40 (Beyotime), 0.1 mM PMSF, and 1× protease inhibitor cocktail set I (Merck Millipore) (51). .. One milliliter aliquots were mixed with 1.8 g glass beads (Biospec Products, Bartlesville, OK) in a 2.0 mL screw-cap tube followed by disruption with a bead disrupter (FastPrep-24, MP) for 20 cycles (1 min vibrating at 6.0 m/s and 5 min resting on ice for each cycle).

Article Title: Trichoderma reesei ACE4, a Novel Transcriptional Activator Involved in the Regulation of Cellulase Genes during Growth on Cellulose
Article Snippet: .. This crude lysate was dissolved in lysis buffer (50 mM Tris-HCl, 100 mM NaCl, 1% NP-40 [Beyotime], 0.1 mM PMSF, and 1× protease inhibitor cocktail set I [Merck Millipore; pH 7.5]). ..

Article Title: Integrin α3 negative podocytes: A gene expression study
Article Snippet: .. The two cell types were lysed with a buffer containing 25 mM Tris-HCl, pH 7.4, 100 mM NaCl, 1% NP-40, 1 mM PEFA-Bloc, 2 mM EDTA and protease inhibitor cocktail set (Merck Chemicals) and phosphatase inhibitor cocktail (Sigma-Aldrich). ..

Article Title: Reduction of 2-methoxy-1,4-naphtoquinone by mitochondrially-localized Nqo1 yielding NAD + supports substrate-level phosphorylation during respiratory inhibition.
Article Snippet: .. Cells were solubilized in RIPA buffer containing a cocktail of protease inhibitors (Protease Inhibitor Cocktail Set I, Merck Millipore, Billerica, MA, USA) and frozen at −80 °C for further analysis. ..

Article Title: Structural and functional insights into TRiC chaperonin from a psychrophilic yeast, Glaciozyma antarctica
Article Snippet: .. Melting curves analysis of the PCR reactions were done to analyze the specificity of each set of primers. table ft1 table-wrap mode="anchored" t5 Table 1 caption a7 Primers Sequence (5–3′) GaTRiCαF-RT GTACTTGACGGAGCAGCTTT GaTRiCαR-RT ATGCTCGCAGTCAAGACCA GaTRiCβF-RT CAAGAGCGAGCAGAGAATGTC GaTRiCβR-RT AGATCACGGTCACCAACGAC GaTRiCγF-RT ATGGAGAGACGGGCAAGGT GaTRiCγR-RT GAGGAGTGCAGAACATGGG GaTRiCδF-RT ATGGCTGCACCTACCACT GaTRiCδR-RT ATGGACAAGATGATCACGACC GaTRiCεF-RT ATCGATTGCGCTGGAAAGGG GaTRiCεR-RT GGTGGTGGAGACGAGGAGTA GaTRiCζF-RT GGTTGTGCAGGGAAGGAAC GaTRiCζR-RT GTAACCAAGCCTTCCAGATCAA GaTRiCηF-RT AGGCCGAATGCCCTACAT GaTRiCηR-RT GGTATGGACAAGCTCATCGTC GaTRiCθF-RT TCAGTAGGCTGTATGCTGCG GaTRiCθR-RT ATTCGCTACGGTACTGACGC Open in a separate window Primers were named based on the TRiC subunits (subunit α, β, γ, δ, ε, ζ, η, and θ), F indicates forward primers, R is for reverse primers, and RT indicates real-time PCR Primers used in real-time PCR analysis Preparation of cells, purification, and protein analysis Harvested cells from G. antarctica culture were homogenized in buffer A containing 20 mM Tris (pH 8), 20 mM KCL, 1 mM EDTA, 1 mM DTT, 1 mM MgCl 2, 0.5 mM PMSF, 1X protease inhibitor cocktail set (500 μM AEBSF hydrochloride, 150 nM Aprotinin, 1 μM E-64 protease inhibitor, 0.5 mM EDTA and 1 μM Leupeptin) (Merck Millipore, Germany) at 4 °C for 50 g cells per 50 mL buffer A. ..

Polymerase Chain Reaction:

Article Title: Structural and functional insights into TRiC chaperonin from a psychrophilic yeast, Glaciozyma antarctica
Article Snippet: .. Melting curves analysis of the PCR reactions were done to analyze the specificity of each set of primers. table ft1 table-wrap mode="anchored" t5 Table 1 caption a7 Primers Sequence (5–3′) GaTRiCαF-RT GTACTTGACGGAGCAGCTTT GaTRiCαR-RT ATGCTCGCAGTCAAGACCA GaTRiCβF-RT CAAGAGCGAGCAGAGAATGTC GaTRiCβR-RT AGATCACGGTCACCAACGAC GaTRiCγF-RT ATGGAGAGACGGGCAAGGT GaTRiCγR-RT GAGGAGTGCAGAACATGGG GaTRiCδF-RT ATGGCTGCACCTACCACT GaTRiCδR-RT ATGGACAAGATGATCACGACC GaTRiCεF-RT ATCGATTGCGCTGGAAAGGG GaTRiCεR-RT GGTGGTGGAGACGAGGAGTA GaTRiCζF-RT GGTTGTGCAGGGAAGGAAC GaTRiCζR-RT GTAACCAAGCCTTCCAGATCAA GaTRiCηF-RT AGGCCGAATGCCCTACAT GaTRiCηR-RT GGTATGGACAAGCTCATCGTC GaTRiCθF-RT TCAGTAGGCTGTATGCTGCG GaTRiCθR-RT ATTCGCTACGGTACTGACGC Open in a separate window Primers were named based on the TRiC subunits (subunit α, β, γ, δ, ε, ζ, η, and θ), F indicates forward primers, R is for reverse primers, and RT indicates real-time PCR Primers used in real-time PCR analysis Preparation of cells, purification, and protein analysis Harvested cells from G. antarctica culture were homogenized in buffer A containing 20 mM Tris (pH 8), 20 mM KCL, 1 mM EDTA, 1 mM DTT, 1 mM MgCl 2, 0.5 mM PMSF, 1X protease inhibitor cocktail set (500 μM AEBSF hydrochloride, 150 nM Aprotinin, 1 μM E-64 protease inhibitor, 0.5 mM EDTA and 1 μM Leupeptin) (Merck Millipore, Germany) at 4 °C for 50 g cells per 50 mL buffer A. ..

Sequencing:

Article Title: Structural and functional insights into TRiC chaperonin from a psychrophilic yeast, Glaciozyma antarctica
Article Snippet: .. Melting curves analysis of the PCR reactions were done to analyze the specificity of each set of primers. table ft1 table-wrap mode="anchored" t5 Table 1 caption a7 Primers Sequence (5–3′) GaTRiCαF-RT GTACTTGACGGAGCAGCTTT GaTRiCαR-RT ATGCTCGCAGTCAAGACCA GaTRiCβF-RT CAAGAGCGAGCAGAGAATGTC GaTRiCβR-RT AGATCACGGTCACCAACGAC GaTRiCγF-RT ATGGAGAGACGGGCAAGGT GaTRiCγR-RT GAGGAGTGCAGAACATGGG GaTRiCδF-RT ATGGCTGCACCTACCACT GaTRiCδR-RT ATGGACAAGATGATCACGACC GaTRiCεF-RT ATCGATTGCGCTGGAAAGGG GaTRiCεR-RT GGTGGTGGAGACGAGGAGTA GaTRiCζF-RT GGTTGTGCAGGGAAGGAAC GaTRiCζR-RT GTAACCAAGCCTTCCAGATCAA GaTRiCηF-RT AGGCCGAATGCCCTACAT GaTRiCηR-RT GGTATGGACAAGCTCATCGTC GaTRiCθF-RT TCAGTAGGCTGTATGCTGCG GaTRiCθR-RT ATTCGCTACGGTACTGACGC Open in a separate window Primers were named based on the TRiC subunits (subunit α, β, γ, δ, ε, ζ, η, and θ), F indicates forward primers, R is for reverse primers, and RT indicates real-time PCR Primers used in real-time PCR analysis Preparation of cells, purification, and protein analysis Harvested cells from G. antarctica culture were homogenized in buffer A containing 20 mM Tris (pH 8), 20 mM KCL, 1 mM EDTA, 1 mM DTT, 1 mM MgCl 2, 0.5 mM PMSF, 1X protease inhibitor cocktail set (500 μM AEBSF hydrochloride, 150 nM Aprotinin, 1 μM E-64 protease inhibitor, 0.5 mM EDTA and 1 μM Leupeptin) (Merck Millipore, Germany) at 4 °C for 50 g cells per 50 mL buffer A. ..

Real-time Polymerase Chain Reaction:

Article Title: Structural and functional insights into TRiC chaperonin from a psychrophilic yeast, Glaciozyma antarctica
Article Snippet: .. Melting curves analysis of the PCR reactions were done to analyze the specificity of each set of primers. table ft1 table-wrap mode="anchored" t5 Table 1 caption a7 Primers Sequence (5–3′) GaTRiCαF-RT GTACTTGACGGAGCAGCTTT GaTRiCαR-RT ATGCTCGCAGTCAAGACCA GaTRiCβF-RT CAAGAGCGAGCAGAGAATGTC GaTRiCβR-RT AGATCACGGTCACCAACGAC GaTRiCγF-RT ATGGAGAGACGGGCAAGGT GaTRiCγR-RT GAGGAGTGCAGAACATGGG GaTRiCδF-RT ATGGCTGCACCTACCACT GaTRiCδR-RT ATGGACAAGATGATCACGACC GaTRiCεF-RT ATCGATTGCGCTGGAAAGGG GaTRiCεR-RT GGTGGTGGAGACGAGGAGTA GaTRiCζF-RT GGTTGTGCAGGGAAGGAAC GaTRiCζR-RT GTAACCAAGCCTTCCAGATCAA GaTRiCηF-RT AGGCCGAATGCCCTACAT GaTRiCηR-RT GGTATGGACAAGCTCATCGTC GaTRiCθF-RT TCAGTAGGCTGTATGCTGCG GaTRiCθR-RT ATTCGCTACGGTACTGACGC Open in a separate window Primers were named based on the TRiC subunits (subunit α, β, γ, δ, ε, ζ, η, and θ), F indicates forward primers, R is for reverse primers, and RT indicates real-time PCR Primers used in real-time PCR analysis Preparation of cells, purification, and protein analysis Harvested cells from G. antarctica culture were homogenized in buffer A containing 20 mM Tris (pH 8), 20 mM KCL, 1 mM EDTA, 1 mM DTT, 1 mM MgCl 2, 0.5 mM PMSF, 1X protease inhibitor cocktail set (500 μM AEBSF hydrochloride, 150 nM Aprotinin, 1 μM E-64 protease inhibitor, 0.5 mM EDTA and 1 μM Leupeptin) (Merck Millipore, Germany) at 4 °C for 50 g cells per 50 mL buffer A. ..

Purification:

Article Title: Structural and functional insights into TRiC chaperonin from a psychrophilic yeast, Glaciozyma antarctica
Article Snippet: .. Melting curves analysis of the PCR reactions were done to analyze the specificity of each set of primers. table ft1 table-wrap mode="anchored" t5 Table 1 caption a7 Primers Sequence (5–3′) GaTRiCαF-RT GTACTTGACGGAGCAGCTTT GaTRiCαR-RT ATGCTCGCAGTCAAGACCA GaTRiCβF-RT CAAGAGCGAGCAGAGAATGTC GaTRiCβR-RT AGATCACGGTCACCAACGAC GaTRiCγF-RT ATGGAGAGACGGGCAAGGT GaTRiCγR-RT GAGGAGTGCAGAACATGGG GaTRiCδF-RT ATGGCTGCACCTACCACT GaTRiCδR-RT ATGGACAAGATGATCACGACC GaTRiCεF-RT ATCGATTGCGCTGGAAAGGG GaTRiCεR-RT GGTGGTGGAGACGAGGAGTA GaTRiCζF-RT GGTTGTGCAGGGAAGGAAC GaTRiCζR-RT GTAACCAAGCCTTCCAGATCAA GaTRiCηF-RT AGGCCGAATGCCCTACAT GaTRiCηR-RT GGTATGGACAAGCTCATCGTC GaTRiCθF-RT TCAGTAGGCTGTATGCTGCG GaTRiCθR-RT ATTCGCTACGGTACTGACGC Open in a separate window Primers were named based on the TRiC subunits (subunit α, β, γ, δ, ε, ζ, η, and θ), F indicates forward primers, R is for reverse primers, and RT indicates real-time PCR Primers used in real-time PCR analysis Preparation of cells, purification, and protein analysis Harvested cells from G. antarctica culture were homogenized in buffer A containing 20 mM Tris (pH 8), 20 mM KCL, 1 mM EDTA, 1 mM DTT, 1 mM MgCl 2, 0.5 mM PMSF, 1X protease inhibitor cocktail set (500 μM AEBSF hydrochloride, 150 nM Aprotinin, 1 μM E-64 protease inhibitor, 0.5 mM EDTA and 1 μM Leupeptin) (Merck Millipore, Germany) at 4 °C for 50 g cells per 50 mL buffer A. ..



Similar Products

99
MedChemExpress protease inhibitor cocktail set iii
Protease Inhibitor Cocktail Set Iii, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/protease+inhibitor+cocktail+set/Protease+Inhibitor+Cocktail/pm42103804-72-9-18
Average 99 stars, based on 1 article reviews
protease inhibitor cocktail set iii - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

99
Thermo Fisher protease inhibitor cocktail set
Protease Inhibitor Cocktail Set, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/protease+inhibitor+cocktail+set/Protease+Inhibitor+Cocktail/pmc13110880-75-6-11
Average 99 stars, based on 1 article reviews
protease inhibitor cocktail set - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

86
Merck & Co protease inhibitor cocktail set iii
Protease Inhibitor Cocktail Set Iii, supplied by Merck & Co, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/protease+inhibitor+cocktail+set/cocktail+inhibitor+protease/pm41612742-254-35-40
Average 86 stars, based on 1 article reviews
protease inhibitor cocktail set iii - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

99
Thermo Fisher protease inhibitor cocktail set v
Protease Inhibitor Cocktail Set V, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/protease+inhibitor+cocktail+set/Protease+Inhibitor+Cocktail/pmc12661204-376-19-57
Average 99 stars, based on 1 article reviews
protease inhibitor cocktail set v - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

86
Merck & Co protease inhibitor cocktail set i
Protease Inhibitor Cocktail Set I, supplied by Merck & Co, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/protease+inhibitor+cocktail+set/cocktail+inhibitor+protease/pm40993749-43-5-10
Average 86 stars, based on 1 article reviews
protease inhibitor cocktail set i - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

90
Merck KGaA protease/phosphatase inhibitor cocktail set
Protease/Phosphatase Inhibitor Cocktail Set, supplied by Merck KGaA, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/protease+inhibitor+cocktail+set/protease+and+phosphatase+inhibitor+cocktail/pmc12265377-73-25-29
Average 90 stars, based on 1 article reviews
protease/phosphatase inhibitor cocktail set - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results